| Gene name |
SPAC23H4.07c |
| Gene ID |
08/G06 |
| Gene synonyms/obsolete |
srp102 |
| Gene product |
GTP-binding protein;
involved in intracellular protein transport; involved in
protein-ER targeting; involved in SRP-dependent
cotranslational membrane targeting |
| Entry clone |
Cloned |
| ORF length (unspliced) |
732 |
| ORF length (spliced) |
684 |
| Entry clone length |
732 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
83T:C / 274T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC23H4.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATGGAACTTCTCAAGC |
| Rev primer name |
SPAC23H4.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTGTAAAGCTGATTCCATC |
| Amino acid length |
227 |
| Molecular weight |
25.6 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |