| Gene name |
SPBC15D4.13c |
| Gene ID |
08/G04 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein;
sequence orphan |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
731 |
| ORF length (spliced) |
639 |
| Entry clone length |
731 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
Possibly merged to
SPBC15D4.12c but can't identify correct splicing. |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC15D4.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGATATCCAAATTTGTT |
| Rev primer name |
SPBC15D4.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCATTAACGAGTAAAGGA |
| Amino acid length |
212 |
| Molecular weight |
24.6 |
| Isoelectric point (calc.) |
7.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus; a few
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |