Gene name |
SPBC16E9.12c |
Gene ID |
07/F06 |
Gene synonyms/obsolete |
pab2 |
Gene product |
poly(A)-binding
protein; involved in polyadenylation; RRM RNA recognition
motif |
Entry clone |
Cloned |
ORF length (unspliced) |
663 |
ORF length (spliced) |
501 |
Entry clone length |
663 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
364A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC16E9.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGATCAAGATGCCTT |
Rev primer name |
SPBC16E9.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATACGGAGCGAAACCACGG |
Amino acid length |
166 |
Molecular weight |
18.4 |
Isoelectric point (calc.) |
8.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
142/144 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus; nuclear
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss, DeltaVision
|