| Gene name |
SPAPYUG7.06 |
| Gene ID |
06/B10 |
| Gene synonyms/obsolete |
|
| Gene product |
DUF862; conserved
eukaryotic protein; human homolog PNAS-4 is acute
promyelocytic leukemia cell line NB4's apoptosis-related gene;
no apparent Sc ortholog |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
606 |
| ORF length (spliced) |
|
| Entry clone length |
606 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
ORF prediction was
changed (extended). 06/B09 was cloned at first. |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAPYUG7.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAGTATACATTAATGT |
| Rev primer name |
SPAPYUG7.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGGAAGTGAATCAGTGATG |
| Amino acid length |
201 |
| Molecular weight |
21.9 |
| Isoelectric point (calc.) |
6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |