| Gene name |
SPCC24B10.03 |
| Gene ID |
06/B05 |
| Gene synonyms/obsolete |
|
| Gene product |
very hypothetical
protein; sequence orphan; predicted coiled-coil region |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
574 |
| ORF length (spliced) |
387 |
| Entry clone length |
574 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC24B10.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATGCTGATGATTTTGG |
| Rev primer name |
SPCC24B10.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACCCAAGTCGTCCAAGACA |
| Amino acid length |
128 |
| Molecular weight |
14.5 |
| Isoelectric point (calc.) |
4.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol; a
few cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |