| Gene name |
SPAC3A12.07 |
| Gene ID |
04/B11 |
| Gene synonyms/obsolete |
rpb11 |
| Gene product |
DNA-directed RNA
polymerase II (subunit); involved in transcription from Pol II
promoter; DNA-directed RNA polymerase activity (function of
complex); DNA-binding activity; interacts physically with
Rpb2p; interacts physically with Rpb3p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
463 |
| ORF length (spliced) |
372 |
| Entry clone length |
463 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
113A:G / 417A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3A12.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATCAGCCAGAACGGTA |
| Rev primer name |
SPAC3A12.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGAAAACTCCATTTCAACG |
| Amino acid length |
123 |
| Molecular weight |
14.1 |
| Isoelectric point (calc.) |
4.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss |