| Gene name |
SPAC6G10.11c |
| Gene ID |
04/A03 |
| Gene synonyms/obsolete |
ubi3 |
| Gene product |
ubiquitin family
protein; nuclear protein; overexpression results in cell cycle
defects |
| Entry clone |
Cloned |
| ORF length (unspliced) |
453 |
| ORF length (spliced) |
|
| Entry clone length |
453 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
163A:G |
| Comments |
Identical to
SPAC589.10c. |
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC6G10.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAGATCTTTGTAAAAAC |
| Rev primer name |
SPAC6G10.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTTTTCCAACTTAAGAGTC |
| Amino acid length |
150 |
| Molecular weight |
17.2 |
| Isoelectric point (calc.) |
10.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
77/72 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear envelope; SPB;
periphery; site of septum formation; nucleus>cytosol |
| Comments for localization |
observed by N-terminal
tagging of GFP |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss, DeltaVision
|