| Gene name |
SPAC30.08 |
| Gene ID |
03/G04 |
| Gene synonyms/obsolete |
SPAC29E6.04 |
| Gene product |
involved in spindle
orientation; involved in mRNA export |
| Entry clone |
Cloned |
| ORF length (unspliced) |
438 |
| ORF length (spliced) |
|
| Entry clone length |
438 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
(+1)T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC30.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTAGTCGAAAGGAGCA |
| Rev primer name |
SPAC30.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTTGCTTTTTCTTCCCGCC |
| Amino acid length |
145 |
| Molecular weight |
16.8 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica, Confocal
|