| Gene name |
SPAC922.01 |
| Gene ID |
03/G02 |
| Gene synonyms/obsolete |
mmf2; hpm1;
SPAC1039.10 |
| Gene product |
eukaryotic conserved
protein; endoribonuclease L-PSP: YjgF family; involved in
mitochondrial protein synthesis (inhibition); involved in
mitochondrial DNA maintenance; translation initiation
inhibitor; similar to Sp mmf1 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
437 |
| ORF length (spliced) |
381 |
| Entry clone length |
437 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
10G:T / 137A:G /
171A:G / 420T:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC922.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCAAAGTTCCTATTAA |
| Rev primer name |
SPAC922.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCTGCCGCAATACATTCG |
| Amino acid length |
126 |
| Molecular weight |
13.3 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |