| Gene name |
SPBC24C6.01c |
| Gene ID |
03/B06 |
| Gene synonyms/obsolete |
ubl1; ned8;
SPBC12D12.08c |
| Gene product |
ubiquitin family
protein; SCF ubiquitin ligase activator; induced by stress;
involved in protein deneddylation; involved in protein
neddylation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
406 |
| ORF length (spliced) |
237 |
| Entry clone length |
406 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
Primer's names are
different from the clone name used now. |
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC12D12.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTATCAAAGTAAAAGT |
| Rev primer name |
SPBC12D12.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCAACTTCCTCCACGAAGA |
| Amino acid length |
78 |
| Molecular weight |
8.6 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
observed by N-terminal
tagging of GFP |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |