| Gene name |
SPAC9G1.03c |
| Gene ID |
02/H06 |
| Gene synonyms/obsolete |
rpl3001; rpl30;
rpl30-1 |
| Gene product |
60S ribosomal protein
L30/L30A |
| Entry clone |
Cloned |
| ORF length (unspliced) |
389 |
| ORF length (spliced) |
330 |
| Entry clone length |
389 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
(-7)C:deletion |
| Comments |
5' terminus is
frameshifted. |
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC9G1.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCATCTGTGGTTACCAA |
| Rev primer name |
SPAC9G1.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCGTCCAAGATGTCAGAG |
| Amino acid length |
109 |
| Molecular weight |
11.5 |
| Isoelectric point (calc.) |
10.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFRVGVLAI |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |