| Gene name |
SPAC9E9.17c |
| Gene ID |
02/F07 |
| Gene synonyms/obsolete |
|
| Gene product |
very hypothetical
protein; sequence orphan; has a good correlation score and
good consensus intron |
| Entry clone |
Cloned
(Re-cloned) |
| ORF length (unspliced) |
375 |
| ORF length (spliced) |
171 |
| Entry clone length |
375 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC9E9.17.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATGTAGGACGAGTGGG |
| Rev primer name |
SPAC9E9.17.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCAATTATTAGTTTTTCGT |
| Amino acid length |
56 |
| Molecular weight |
6.4 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |