| Gene name |
SPMIT.09 |
| Gene ID |
52/D09 |
| Gene synonyms/obsolete |
|
| Gene product |
atp8, F0-ATPase
subunit 8, similar to S. cerevisiae ATP8 |
| Entry clone |
#Not cloned yet |
| ORF length (unspliced) |
147 |
| ORF length (spliced) |
|
| Entry clone length |
147 |
| No. of intron |
0 |
| Sequence status |
#Not cloned yet |
| Sequence results |
#Not cloned yet |
| Comments |
|
| Polymerase used for cloning |
|
| Fwd primer name |
SPMIT.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCACAATTAGTACCATT |
| Rev primer name |
SPMIT.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAAAGAACTTATAATAGAT |
| Amino acid length |
|
| Molecular weight |
|
| Isoelectric point (calc.) |
|
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
|
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
|
| Localization (YFP) |
not cloned |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|