Gene name |
SPAP7G5.06 |
Gene ID |
52/B05 |
Gene synonyms/obsolete |
|
Gene product |
amino acid permease
family; similar to Sp SPAC869.11 and SPBC359.01 and meu22 and
SPBPB2B2.01 and isp5 |
Entry clone |
Cloned |
ORF length (unspliced) |
1752 |
ORF length (spliced) |
|
Entry clone length |
1752 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAP7G5.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGTCGCCAGATCGCTC |
Rev primer name |
SPAP7G5.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGCAAAGAGATTGCCAAATC |
Amino acid length |
583 |
Molecular weight |
64 |
Isoelectric point (calc.) |
7.8 |
Signal SEQ |
|
No. of transmembrane domain |
11 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
Golgi; periphery at
cell tip |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss |