| Gene name |
SPAC11E3.06 |
| Gene ID |
52/B03 |
| Gene synonyms/obsolete |
map1 |
| Gene product |
pheromone receptor
transcriptional activator; MADS-box domain; SRF-type
transcription factor (DNA-binding and dimerization); involved
in mating-type determination; involved in the transcription of
mating-type specific genes; involved in P-cell specific gene
expression (required) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1550 |
| ORF length (spliced) |
1197 |
| Entry clone length |
1550 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC11E3.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATGGATGAAAGAAAGCT |
| Rev primer name |
SPAC11E3.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCTCCGTAAATGATCAAAT |
| Amino acid length |
398 |
| Molecular weight |
44.4 |
| Isoelectric point (calc.) |
5.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |