Gene name |
SPAC1F8.08 |
Gene ID |
51/H03 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein;
sequence orphan |
Entry clone |
Cloned |
ORF length (unspliced) |
363 |
ORF length (spliced) |
|
Entry clone length |
363 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC1F8.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTACAAGCGGGATGCT |
Rev primer name |
SPAC1F8.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTTGGCCTGGCCTGGCTG |
Amino acid length |
120 |
Molecular weight |
13.8 |
Isoelectric point (calc.) |
9.2 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
2 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |