| Gene name |
SPAPB1A11.01 |
| Gene ID |
50/G07 |
| Gene synonyms/obsolete |
SPAPB24D3.11 |
| Gene product |
membrane transporter;
similar to Sp SPBC1348.05 and SPAC750.02c and SPBPB2B2.16c
(paralogs); similar to C. albicans fluconazole resistance
protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1488 |
| ORF length (spliced) |
|
| Entry clone length |
1488 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1048T:C /
1425A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAPB1A11.01.Fd |
| Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGTCTGTTTCTGACAAGGA |
| Rev primer name |
SPAPB1A11.01.Rv |
| Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTAGTATTTTGTATGATCAAAG |
| Amino acid length |
495 |
| Molecular weight |
55.3 |
| Isoelectric point (calc.) |
8.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
12 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVTTIRRPLHL |
| Localization (YFP) |
periphery; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |