Gene name |
SPBP19A11.06 |
Gene ID |
49/H05 |
Gene synonyms/obsolete |
lid2;
SPBP4H10.01 |
Gene product |
Lid family protein;
DNA-binding protein; zinc finger protein; zf-PHD finger;
zf-C5HC2 type; jmjC domain; Arid/BRIGHT domain; similar domain
organization to human retinoblastoma binding protein 2;
involved in transcriptional regulation (implicated); interacts
physically with SET1 complex; involved in regulation of
chromatin remodeling (implicated); similar to Sp SPAC343.11c
(paralog) |
Entry clone |
Cloned |
ORF length (unspliced) |
4542 |
ORF length (spliced) |
|
Entry clone length |
4542 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
2262A:G /
3601C:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBP19A11.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATATGCCAGCTTTTGTG |
Rev primer name |
SPBP19A11.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATACATTTAGAAAATTCTCG |
Amino acid length |
1513 |
Molecular weight |
172.2 |
Isoelectric point (calc.) |
7.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LHKVIIYLRL/LVPNIQALKL/LGFTIPELGI |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |