| Gene name |
SPAC3H5.06c |
| Gene ID |
49/H03 |
| Gene synonyms/obsolete |
pol1; swi7; polA |
| Gene product |
DNA polymerase alpha
(catalytic subunit); involved in DNA replication (initiation);
replication initiation complex component; essential; involved
in S/M checkpoint (required); involved in mating-type
switching (required); involved in transcriptional silencing;
involved in DNA repair; involved in telomere maintenance |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4309 |
| ORF length (spliced) |
4218 |
| Entry clone length |
4309 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
510T:C / 772T:C /
1091T:deletion / 1321A:G / 2746G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3H5.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGAAAGAGAAACGCGGG |
| Rev primer name |
SPAC3H5.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACGATGAAAATATCAGTCCC |
| Amino acid length |
1405 |
| Molecular weight |
159.3 |
| Isoelectric point (calc.) |
6.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
96/96 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSEIVLKELDI |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |