| Gene name |
SPBC800.01 |
| Gene ID |
49/G01 |
| Gene synonyms/obsolete |
SPBC31E1.06 |
| Gene product |
GTP-binding protein;
involved in ribosome biogenesis and assembly; AAA family
ATPase; involved in 18S rRNA biogenesis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3413 |
| ORF length (spliced) |
3366 |
| Entry clone length |
3413 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
433T:C / 466A:G /
1082T:C / 1693A:G / 1840G:A / 2071A:G / 2336A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC800.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACGAGAAGAAGGGCCA |
| Rev primer name |
SPBC800.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTTTTTGATCTTTTCCCT |
| Amino acid length |
1121 |
| Molecular weight |
127.6 |
| Isoelectric point (calc.) |
7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
181 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LADRMEDLTL |
| Localization (YFP) |
nucleolus>>nucleus; spindle microtubules |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |