Gene name |
SPAC3H5.03c |
Gene ID |
49/F02 |
Gene synonyms/obsolete |
klp1; pkl1;
SPAC3A11.14c |
Gene product |
kinesin-like protein;
Kar3 subfamily; ATPase; involved in mitotic spindle function;
similar to Sp SPAC664.10 |
Entry clone |
Cloned |
ORF length (unspliced) |
2719 |
ORF length (spliced) |
2499 |
Entry clone length |
2719 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
380A:G / 1402A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC3H5.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTAATTGAGGTAAGAGG |
Rev primer name |
SPAC3H5.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACGTTTATAATGTTTAATA |
Amino acid length |
832 |
Molecular weight |
96.3 |
Isoelectric point (calc.) |
6.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB?; nuclear dots;
nucleus |
Comments for localization |
anaphase SPB? |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal,
DeltaVision |