Gene name |
SPAC3H5.08c |
Gene ID |
49/E11 |
Gene synonyms/obsolete |
|
Gene product |
WD repeat protien
|
Entry clone |
Cloned |
ORF length (unspliced) |
2605 |
ORF length (spliced) |
2568 |
Entry clone length |
2605 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
2286C:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC3H5.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAACGGACTAGATCTGA |
Rev primer name |
SPAC3H5.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGGAAGAGTACTCATTTCA |
Amino acid length |
855 |
Molecular weight |
95.1 |
Isoelectric point (calc.) |
8.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSGSLDCKLRL |
Localization (YFP) |
SPB?; nuclear dots;
nucleus; periphery? ER? |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |