| Gene name |
SPBC713.04c |
| Gene ID |
49/E09 |
| Gene synonyms/obsolete |
|
| Gene product |
WD repeat protein;
ribonucleoprotein (RNP) complex; processome component;
involved in rRNA processing; involved in cytokinesis; involved
in cell separation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2565 |
| ORF length (spliced) |
|
| Entry clone length |
2565 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
714T:C / 778G:A /
1532A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC713.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAACTGAATTTGGGTT |
| Rev primer name |
SPBC713.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCCGTATTTTCCAAACGT |
| Amino acid length |
854 |
| Molecular weight |
95.4 |
| Isoelectric point (calc.) |
6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LISLVMALRL |
| Localization (YFP) |
nucleolus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleolus>>nucleus;
cytoplasmic dots) |
| Microscope used for
observation |
Leica |