| Gene name |
SPBC1271.02 |
| Gene ID |
49/E02 |
| Gene synonyms/obsolete |
stt3 |
| Gene product |
oligosaccharyltransferase subunit; functional
homolog of Sc YGL022W; involved in glycosylation; involved in
the regulation of oligosaccharyltransferase activity;
essential |
| Entry clone |
Cloned in 2004
trial |
| ORF length (unspliced) |
2318 |
| ORF length (spliced) |
2259 |
| Entry clone length |
2318 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC1271.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTAATTCTGCTACAAT |
| Rev primer name |
SPBC1271.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACCCTCAAAGGAATTTCG |
| Amino acid length |
752 |
| Molecular weight |
84.9 |
| Isoelectric point (calc.) |
9.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
11 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGVFGLLQL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |