| Gene name |
SPBC32H8.10 |
| Gene ID |
49/D01 |
| Gene synonyms/obsolete |
pi014;
SPACTOKYO_453.22 |
| Gene product |
Cdc2 kinase homologue;
cyclin-dependent protein kinase; P-TEFb factor;
serine/threonine protein kinase; involved in transcription
from RNA polymerase II; complexed with Pch1p; interacts
physically with Pch1p (Cdk domain); interacts physically with
Pct1p; interacts physically with Spt5p; phosphorylates Spt5p
(CTD)interacts physically with Rpb1p; phosphorylates
Rpb1p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1947 |
| ORF length (spliced) |
1776 |
| Entry clone length |
1947 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC32H8.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAACGCTCAAGCAGCGT |
| Rev primer name |
SPBC32H8.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTAGGAGTGTCATCAACG |
| Amino acid length |
591 |
| Molecular weight |
68 |
| Isoelectric point (calc.) |
9.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |