Gene name |
SPAC1F3.06c |
Gene ID |
48/H10 |
Gene synonyms/obsolete |
spo15 |
Gene product |
involved in
sporulation (required); mutant defective in spore formation;
predicted coiled-coil protein; colocalizes with sad1 spindle
pole body component during meiotic and vegetative growth; no
apparent Sc ortholog; required for ascospore formation;
essential |
Entry clone |
Cloned |
ORF length (unspliced) |
5874 |
ORF length (spliced) |
|
Entry clone length |
5874 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC1F3.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGAATCAGTCGTCTTC |
Rev primer name |
SPAC1F3.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAACACAAGAGAGGTTCTCG |
Amino acid length |
1957 |
Molecular weight |
222.7 |
Isoelectric point (calc.) |
4.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
1743 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKEVNGKLSL/LDKLTGKLKI/LSRLTVLSL |
Localization (YFP) |
SPB |
Comments for localization |
cytoplasmic dots by
over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |