| Gene name |
SPAC6B12.02c |
| Gene ID |
48/H08 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein;
similar to N. crassa B8B20.20; no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5667 |
| ORF length (spliced) |
|
| Entry clone length |
5667 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1271A:deletion /
5568T:A |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC6B12.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATAGTTTCCTTTTACT |
| Rev primer name |
SPAC6B12.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAACAATACAATATCAAAA |
| Amino acid length |
1888 |
| Molecular weight |
217.4 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
554 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKEDVVDQLWL/LNSILQLDI/LISLKAWLHL/LKVTFDEYLAL/LKNPILLNLPI/LAAMFYSLLLL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|