| Gene name |
SPAC19B12.03 |
| Gene ID |
48/H06 |
| Gene synonyms/obsolete |
bgs3 |
| Gene product |
1,3-beta-glucan
synthase subunit; glycosyl transferase family 48; essential;
involved in cell wall biosynthesis (required); involved in
cellular elongation; similar to Sp SPCC1840.02c and
SPBC19G7.05c and SPAC24C9.07c |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5481 |
| ORF length (spliced) |
|
| Entry clone length |
5481 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC19B12.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTATAAAAAGGGTGA |
| Rev primer name |
SPAC19B12.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCGGATGTATTTTTGTTA |
| Amino acid length |
1826 |
| Molecular weight |
210.8 |
| Isoelectric point (calc.) |
8.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
16 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVYLTDLVL/LFSLTPILCI |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |