Gene name |
SPAC19B12.03 |
Gene ID |
48/H06 |
Gene synonyms/obsolete |
bgs3 |
Gene product |
1,3-beta-glucan
synthase subunit; glycosyl transferase family 48; essential;
involved in cell wall biosynthesis (required); involved in
cellular elongation; similar to Sp SPCC1840.02c and
SPBC19G7.05c and SPAC24C9.07c |
Entry clone |
Cloned |
ORF length (unspliced) |
5481 |
ORF length (spliced) |
|
Entry clone length |
5481 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC19B12.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTATAAAAAGGGTGA |
Rev primer name |
SPAC19B12.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCGGATGTATTTTTGTTA |
Amino acid length |
1826 |
Molecular weight |
210.8 |
Isoelectric point (calc.) |
8.1 |
Signal SEQ |
|
No. of transmembrane domain |
16 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVYLTDLVL/LFSLTPILCI |
Localization (YFP) |
cytoplasmic dots |
Comments for localization |
aggregates by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |