Gene name |
SPAC630.13c |
Gene ID |
48/F09 |
Gene synonyms/obsolete |
tsc2 |
Gene product |
tuberin-like protein;
GTPase activating protein; Rap_GAp domain; possibly
facilitates vesicular docking; similar to Sp SPAC18B11.11; no
apparent Sc ortholog; similar to human TS2 (tuberous
sclereosis 2); cytosolic chaperone for hamartin; predicted to
interact with SPAC22F3.13; involved in intracellular protein
transport; involved in cell growth arrest (implicated);
deletion mutant results in defective nutrient uptake; deletion
mutant results in conjugation defects; involved in
conjugation; involved in protein trafficking;
non-essential |
Entry clone |
Cloned |
ORF length (unspliced) |
4020 |
ORF length (spliced) |
|
Entry clone length |
4020 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC630.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACAATAAATCACTTTT |
Rev primer name |
SPAC630.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAAATAACTAGTAAAGTCC |
Amino acid length |
1339 |
Molecular weight |
154.8 |
Isoelectric point (calc.) |
6.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQIWFLSLRL |
Localization (YFP) |
cytosol=nucleus;
cytoplasmic dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |