Gene name |
SPAC10F6.02c |
Gene ID |
48/D08 |
Gene synonyms/obsolete |
prp22 |
Gene product |
ATP-dependent RNA
helicase; involved in mRNA splicing; complexed with
Cdc5p |
Entry clone |
Cloned |
ORF length (unspliced) |
3560 |
ORF length (spliced) |
3507 |
Entry clone length |
3560 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC10F6.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACGATCTGAAAGAATT |
Rev primer name |
SPAC10F6.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACGACCTCCCTTTCGTTGC |
Amino acid length |
1168 |
Molecular weight |
131.4 |
Isoelectric point (calc.) |
7.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKELEYLSL/LGDSIPELVI |
Localization (YFP) |
nuclear dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |