| Gene name |
SPAC4F10.01 |
| Gene ID |
48/B11 |
| Gene synonyms/obsolete |
SPAC20G4.08 |
| Gene product |
hypothetical protein;
sequence orphan; hypothetical protein; sequence orphan;
predicted coiled-coil |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3314 |
| ORF length (spliced) |
3231 |
| Entry clone length |
3314 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC4F10.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATGAGCAAGATCTATT |
| Rev primer name |
SPAC4F10.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTACTGGATGCAACGGAT |
| Amino acid length |
1076 |
| Molecular weight |
119.2 |
| Isoelectric point (calc.) |
4.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLNSLRRDLNL |
| Localization (YFP) |
cytoplasmic dots
|
| Comments for localization |
bright large dots by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |