| Gene name |
SPCC16C4.09 |
| Gene ID |
48/A05 |
| Gene synonyms/obsolete |
sts5 |
| Gene product |
RNB-like protein;
ribonuclease; essential; involved in cell polarity
(maintenance) (required); interacts (functionally) with
protein kinase C; interacts genetically with osmosensing
MAP-kinase pathway; target of the inhibitor staurosporine
|
| Entry clone |
Cloned# |
| ORF length (unspliced) |
3201 |
| ORF length (spliced) |
|
| Entry clone length |
3201 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC16C4.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATGAGGAGTTTGAAAA |
| Rev primer name |
SPCC16C4.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAACTCGACATTTGAAACG |
| Amino acid length |
1066 |
| Molecular weight |
117.6 |
| Isoelectric point (calc.) |
7.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LASQMMSLGI |
| Localization (YFP) |
cytoplasmic dots;
cytosol; periphery at site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |