Gene name |
SPBC2G2.08 |
Gene ID |
47/H11 |
Gene synonyms/obsolete |
ade9 |
Gene product |
C-1-tetrahydrofolate
synthase; methylenetetrahydrofolate dehydrogenase;
methylenetetrahydrofolate cyclohydrolase;
formyltetrahydrofolate synthetase; involved in purine
biosynthesis |
Entry clone |
Cloned |
ORF length (unspliced) |
3177 |
ORF length (spliced) |
2910 |
Entry clone length |
3177 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC2G2.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTTCGTTTAATCAATT |
Rev primer name |
SPBC2G2.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGACAGCCCAACAATTTCT |
Amino acid length |
969 |
Molecular weight |
105.4 |
Isoelectric point (calc.) |
8.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVTTVKALKL |
Localization (YFP) |
mitochondrion |
Comments for localization |
aggregates |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |