Gene name |
SPAC607.01 |
Gene ID |
47/H04 |
Gene synonyms/obsolete |
psc3;
SPAC17H9.20 |
Gene product |
cohesin subunit;
essential; involved in sister chromatid cohesion (S phase)
(required); involved in mitotic progression; STAG domain |
Entry clone |
Cloned |
ORF length (unspliced) |
3118 |
ORF length (spliced) |
2937 |
Entry clone length |
3118 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC607.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGAGTCTGTTACTAC |
Rev primer name |
SPAC607.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTCAAAAACTCATCCACA |
Amino acid length |
978 |
Molecular weight |
112.5 |
Isoelectric point (calc.) |
5.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLSNFVSQLSI/LKVLKLILDI |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |