| Gene name |
SPCC132.01c |
| Gene ID |
47/H01 |
| Gene synonyms/obsolete |
SPCC1322.17c |
| Gene product |
conserved
hypothetical; conserved eukaryotic protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3111 |
| ORF length (spliced) |
3066 |
| Entry clone length |
3111 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC132.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGCAAAGATTTTCCGC |
| Rev primer name |
SPCC132.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTCTTTGACTTTTTGGTA |
| Amino acid length |
1021 |
| Molecular weight |
114.2 |
| Isoelectric point (calc.) |
8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
791/702 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNQGMDWLDI |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
| Microscope used for
observation |
Leica |