| Gene name |
SPCC16C4.14c |
| Gene ID |
47/G04 |
| Gene synonyms/obsolete |
sfc4 |
| Gene product |
RNA polymerase III
transcription factor (TFIIIC subunit); Brf-associated binding
subunit; predicted to bind SPBC13E7.10c (brf); TPR repeat
protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3021 |
| ORF length (spliced) |
|
| Entry clone length |
3021 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC16C4.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTCAAAATGGTGGAAA |
| Rev primer name |
SPCC16C4.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAAATCAAATATTTGGAA |
| Amino acid length |
1006 |
| Molecular weight |
116.4 |
| Isoelectric point (calc.) |
5.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPHLFRTKLGI |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |