Gene name |
SPCC1450.12 |
Gene ID |
47/E02 |
Gene synonyms/obsolete |
|
Gene product |
sorting nexin;
involved in intracellular protein transport; PX domain;
phosphoinositide binding |
Entry clone |
Cloned |
ORF length (unspliced) |
2921 |
ORF length (spliced) |
2466 |
Entry clone length |
2921 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC1450.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATACAGCATCTCCAGA |
Rev primer name |
SPCC1450.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGATATCCTTCTCATTCTCA |
Amino acid length |
821 |
Molecular weight |
96.1 |
Isoelectric point (calc.) |
5.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
771 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKKELFSLLI/LLKFQNMLTL/LPVTMDELGI |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |