Gene name |
SPBC947.11c |
Gene ID |
47/C12 |
Gene synonyms/obsolete |
|
Gene product |
Sc EFD1 is required
for stability of direct DNA repeats; AAA family ATPase
(inferred from context) |
Entry clone |
Cloned |
ORF length (unspliced) |
2854 |
ORF length (spliced) |
2763 |
Entry clone length |
2854 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC947.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAAATTGTAGGCTATTT |
Rev primer name |
SPBC947.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCTAGAGTTGTTGAAAAC |
Amino acid length |
920 |
Molecular weight |
103.8 |
Isoelectric point (calc.) |
5.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
except nucleolus |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |