Gene name |
SPAC57A7.06 |
Gene ID |
47/C08 |
Gene synonyms/obsolete |
|
Gene product |
ribonucleoprotein
(RNP) complex; small subunit (SSU) processome component;
involved in rRNA processing; predicted coiled-coil protein;
predicted ATP/GTP binding (prosite) |
Entry clone |
Cloned |
ORF length (unspliced) |
2836 |
ORF length (spliced) |
2790 |
Entry clone length |
2836 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC57A7.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTAGGAAAGGAAAAGT |
Rev primer name |
SPAC57A7.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTAGGTGCCTTAATAGGA |
Amino acid length |
929 |
Molecular weight |
105 |
Isoelectric point (calc.) |
4.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
237 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleolus>>nucleus? |
Comments for localization |
aggregates |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |