| Gene name |
SPAC144.06 |
| Gene ID |
46/H12 |
| Gene synonyms/obsolete |
apl5 |
| Gene product |
AP-3 complex; adaptin;
clathrin-associated; involved in vesicle-mediated transport
|
| Entry clone |
Cloned; Mixture |
| ORF length (unspliced) |
2596 |
| ORF length (spliced) |
2505 |
| Entry clone length |
2596 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
Mixture |
| Comments |
Mixture of 2 clones,
one of which is frameshifted from somewhere |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC144.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTGTTTGAAAGGACACT |
| Rev primer name |
SPAC144.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATACCTTTTTCTTTTTCTTT |
| Amino acid length |
834 |
| Molecular weight |
94.1 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
823 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSHFSTLGL/LKYIALLCL/LLMLLIILFL |
| Localization (YFP) |
nuclear dots;
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to: nucleus
(intranuclear microtubule bundle?) |
| Microscope used for
observation |
DeltaVision |