Gene name |
SPBC12C2.05c |
Gene ID |
46/G10 |
Gene synonyms/obsolete |
|
Gene product |
DAG domain;
diacylglycerol binding domain; src (SH3) homology domain;
involved in actin cortical patch distribution; actin cortical
patch component |
Entry clone |
Cloned |
ORF length (unspliced) |
2313 |
ORF length (spliced) |
1929 |
Entry clone length |
2313 |
No. of intron |
7 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC12C2.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCCTGGAAACATACAA |
Rev primer name |
SPBC12C2.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATACATCTGTAACATAACTA |
Amino acid length |
642 |
Molecular weight |
72.2 |
Isoelectric point (calc.) |
4.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
periphery at cell tip
and site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |