Gene name |
SPAC15A10.13 |
Gene ID |
46/F11 |
Gene synonyms/obsolete |
|
Gene product |
serine/threonine
protein kinase; POLO family protein kinase |
Entry clone |
Cloned |
ORF length (unspliced) |
2215 |
ORF length (spliced) |
1914 |
Entry clone length |
2215 |
No. of intron |
6 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC15A10.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTTTATAAAATCAGC |
Rev primer name |
SPAC15A10.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAACCCCCAACTTTCCTCT |
Amino acid length |
637 |
Molecular weight |
71.6 |
Isoelectric point (calc.) |
5.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNILFLLLSI/LFPSVVPLLI |
Localization (YFP) |
Golgi |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |