Gene name |
SPAC6F12.12 |
Gene ID |
46/F01 |
Gene synonyms/obsolete |
par2; pbp2 |
Gene product |
protein phosphatase
PP2A, B' regulatory subunit; involved in cytokinesis; involved
in cellular morphogenesis; involved in stress tolerance |
Entry clone |
Cloned |
ORF length (unspliced) |
2129 |
ORF length (spliced) |
1884 |
Entry clone length |
2129 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC6F12.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAGGATTAAGGAGTAA |
Rev primer name |
SPAC6F12.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCTTAAATAATCAGTGGGT |
Amino acid length |
627 |
Molecular weight |
72.4 |
Isoelectric point (calc.) |
6.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRSKFVKALSL/LEEVYLLFI |
Localization (YFP) |
periphery at cell tip
and site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |