Gene name |
SPAC17G6.18 |
Gene ID |
46/E07 |
Gene synonyms/obsolete |
SPAC1142.01 |
Gene product |
conserved eukaryotic
protein; predicted coiled-coil region; DUF654; similar to
mouse nulp1 |
Entry clone |
Cloned |
ORF length (unspliced) |
2098 |
ORF length (spliced) |
2004 |
Entry clone length |
2098 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC17G6.18.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAATATTTTCTGTATGT |
Rev primer name |
SPAC17G6.18.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCCCCTTGACCCATCTCT |
Amino acid length |
667 |
Molecular weight |
76.3 |
Isoelectric point (calc.) |
4.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
99 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSELLDTLNI |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |