Gene name |
SPBC243.01 |
Gene ID |
46/D02 |
Gene synonyms/obsolete |
mph1; SPBC1271.16c;
SPBC106.01 |
Gene product |
yeast spindle
checkpoint protein kinase Mps Mps1-like family;
serine/threonine protein kinase; dual specificity protein
kinase; involved in spindle assembly checkpoint (required);
non-essential |
Entry clone |
Cloned |
ORF length (unspliced) |
2037 |
ORF length (spliced) |
|
Entry clone length |
2037 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC243.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTAAGCGCAATCCTCC |
Rev primer name |
SPBC243.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCTGGCATTTTTCGTAAA |
Amino acid length |
678 |
Molecular weight |
75.3 |
Isoelectric point (calc.) |
7.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |