Gene name |
SPBC24C6.02 |
Gene ID |
46/B11 |
Gene synonyms/obsolete |
|
Gene product |
putative ATP dependent
RNA helicase DEAD/DEAH box helicase; ATP-dependent; RNA
helicase; helicase C-terminal domain; involved in 35S
transcript processing; involved in ribosome biogenesis and
assembly |
Entry clone |
Cloned |
ORF length (unspliced) |
1950 |
ORF length (spliced) |
1821 |
Entry clone length |
1950 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC24C6.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTTTTCAGAGTATTAA |
Rev primer name |
SPBC24C6.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACATACTAAATCCAAAGGAT |
Amino acid length |
606 |
Molecular weight |
68.7 |
Isoelectric point (calc.) |
10.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
531/493 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleolus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |