Gene name |
SPAC2F3.15 |
Gene ID |
46/B09 |
Gene synonyms/obsolete |
|
Gene product |
putative cell division
protein kinase; serine/threonine protein kinase |
Entry clone |
Cloned; Mixture |
ORF length (unspliced) |
1945 |
ORF length (spliced) |
1782 |
Entry clone length |
1945 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
Mixture |
Comments |
Sequence quality is
low / Mixture of 2 clones, one of which is frameshifted from
somewhere. |
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC2F3.15.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCATACTCGAAGAGTAC |
Rev primer name |
SPAC2F3.15.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCTTTTAGATTTTCGTTTT |
Amino acid length |
593 |
Molecular weight |
67.3 |
Isoelectric point (calc.) |
10.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleolus>nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |