Gene name |
SPCC1235.09 |
Gene ID |
46/A09 |
Gene synonyms/obsolete |
|
Gene product |
WD repeat protein;
LisH domain |
Entry clone |
Cloned |
ORF length (unspliced) |
1875 |
ORF length (spliced) |
1695 |
Entry clone length |
1875 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
600A:G |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC1235.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATACGAATCAAGTTAA |
Rev primer name |
SPCC1235.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACAGAGAATCATGTAAAAAA |
Amino acid length |
564 |
Molecular weight |
62.7 |
Isoelectric point (calc.) |
4.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRYNLRISLLL |
Localization (YFP) |
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |