| Gene name |
SPAC24B11.11c |
| Gene ID |
45/H10 |
| Gene synonyms/obsolete |
sid2 |
| Gene product |
Sid2p-Mob1p kinase
complex; serine/threonine protein kinase; SIN component;
protein kinase C terminal domain; involved in cytokinesis
(required); involved in septation (required); spindle pole
body kinase; expression peaks at M-G1 phase; regulated by PBF
transcription complex; protein kinase activity Mob1p
dependent; phosphoprotein; similar to S. cerevisiae
YGR092W and YPR111W; essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1824 |
| ORF length (spliced) |
|
| Entry clone length |
1824 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC24B11.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATCGTGTTAATGATAT |
| Rev primer name |
SPAC24B11.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAATAGAGTCCCGAAAGAA |
| Amino acid length |
607 |
| Molecular weight |
70.4 |
| Isoelectric point (calc.) |
8.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol; SPB |
| Comments for localization |
cytoplasmic dots by
over expression |
| Effect of LMB on protein
localization |
changed to: nucleus
(intranuclear microtubule bundle?) |
| Microscope used for
observation |
DeltaVision |