Gene name |
SPCC24B10.07 |
Gene ID |
45/G11 |
Gene synonyms/obsolete |
|
Gene product |
serine/threonine
protein kinase; AGC family; TOR signaling pathway;
non-essential; involved in conjugation (required); involved in
the regulation of G1 progression; phosphorylated by Tor1p; C2
domain (SMART) |
Entry clone |
Cloned in 2004
trial |
ORF length (unspliced) |
1781 |
ORF length (spliced) |
1710 |
Entry clone length |
1781 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC24B10.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCTGGAAACTTACAAA |
Rev primer name |
SPCC24B10.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCTAATGACACTTCCAGGT |
Amino acid length |
569 |
Molecular weight |
63.7 |
Isoelectric point (calc.) |
8.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |